|
Oxford Instruments
7 3 1 bitplane ![]() 7 3 1 Bitplane, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/7 3 1 bitplane/product/Oxford Instruments Average 99 stars, based on 1 article reviews
7 3 1 bitplane - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
MathWorks Inc
matlab-based custom-built eeglab plug-in ![]() Matlab Based Custom Built Eeglab Plug In, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/matlab-based custom-built eeglab plug-in/product/MathWorks Inc Average 90 stars, based on 1 article reviews
matlab-based custom-built eeglab plug-in - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
MathWorks Inc
matlab plugin 17 - Matlab Plugin, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/matlab plugin/product/MathWorks Inc Average 90 stars, based on 1 article reviews
matlab plugin - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
MACHEREY NAGEL
plasmid dna purification ![]() Plasmid Dna Purification, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmid dna purification/product/MACHEREY NAGEL Average 90 stars, based on 1 article reviews
plasmid dna purification - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Danaher Inc
sh30070 03 ![]() Sh30070 03, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sh30070 03/product/Danaher Inc Average 94 stars, based on 1 article reviews
sh30070 03 - by Bioz Stars,
2026-03
94/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Cell
Article Title: Distinct Hippocampal Pathways Mediate Dissociable Roles of Context in Memory Retrieval
doi: 10.1016/j.cell.2016.09.051
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: N/A TTX Latoxan, Valence, France L8503 CNQX Tocris Bioscience, Bristol, UK 1045 R-CPP Tocris Bioscience, Bristol, UK 0247 QX-314 Tocris Bioscience, Bristol, UK 2313 Picrotoxin Sigma-Aldrich P1675 Fetal bovine serum (FBS) Hyclone SH30070.03 Critical Commercial Assays Rapid DNA Ligation Kit Roche 11 635 379 001 Plasmid DNA Purification MACHEREY-NAGEL N/A Endotoxin-free Plasmid DNA Purification MACHEREY-NAGEL N/A In-Fusion HD cloning kit Clontech 639649 Experimental Models: Cell Lines B7GG Callaway E., Salk Institute N/A BHK-EnVA Callaway E., Salk Institute N/A HEK293-TVA Young J., Salk Institute N/A HEK293T Callaway E., Salk Institute N/A Experimental Models: Organisms/Strains C57BL6/J Harlan Ltd N/A hCAR (transgenic expression of a truncated human receptor for CAV-Cre) Pettersson, S., Karolinska Institutet, Tallone et al., 2001 N/A LSL-R26 Tva-lacZ (Rosa-LSL-TVA, Cre-dependent TVA expression) Saur, D., Technische Universitat Munchen, Seidler et al., 2008 N/A GAD2 Cre Huang, Z. J., Cold Spring Harbor Laboratory, Taniguchi et al., 2011 N/A GAD2 Cre ::LSL-R26 Tva-lacZ (GAD2-Cre-TVA) This paper N/A C57BL6/J::hCAR (F1) This paper N/A Recombinant DNA pSADΔG-ArchT-GFP This paper N/A pAAV-EF1α-DIO-rabG This paper N/A pcDNA-B19N Callaway E., Salk Institute N/A pcDNA-B19P Callaway E., Salk Institute N/A pcDNA-B19L Callaway E., Salk Institute N/A pcDNA-B19G Callaway E., Salk Institute N/A pSADΔG-F3 Callaway E., Salk Institute N/A Sequence-Based Reagents NheI-covering forward primer for Rabies G (GGCCAAGCTAGCATGGTTCCTCAGGCTCTCCTGT) Sigma-Aldrich N/A AscI-covering reverse primer for Rabies G (TTAAGGCGCGCCTTACAGTCTGGTCTCACCCCC) Sigma-Aldrich N/A Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ Fiji 1.48 http://fiji.sc/ TrackEM plugin in Fiji 1.48 Cardona A. and Saalfeld S. http://imagej.net/TrakEM2 Turboreg plugin in ImageJ Thévenaz et al., 1998 N/A GraphPad Prism GraphPad Software Inc http://www.graphpad.com/scientific-software/prism/
Techniques: Recombinant, Plasmid Preparation, DNA Ligation, DNA Purification, Clone Assay, Transgenic Assay, Expressing, Sequencing, Software, Microscopy
17 - Journal: Immunoinformatics (Amsterdam, Netherlands)
Article Title: CelltrackR: An R package for fast and flexible analysis of immune cell migration data
doi: 10.1016/j.immuno.2021.100003
Figure Lengend Snippet: Comparison between celltrackR and existing software for cell migration data. The table lists accessibility and implemented functionalities for each available resource (as assessed from the online documentation provided by the software authors).[
Article Snippet: *With PACT, Track Manager, and Motion Profiler plugins , R package (RP), Java GUI (JG), ImageJ/Icy plugins (IP), Standalone (S),
Techniques: Comparison, Software, Migration, Chemotaxis Assay
Journal: Cell
Article Title: Distinct Hippocampal Pathways Mediate Dissociable Roles of Context in Memory Retrieval
doi: 10.1016/j.cell.2016.09.051
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: N/A TTX Latoxan, Valence, France L8503 CNQX Tocris Bioscience, Bristol, UK 1045 R-CPP Tocris Bioscience, Bristol, UK 0247 QX-314 Tocris Bioscience, Bristol,
Techniques: Recombinant, Polymer, Plasmid Preparation, DNA Ligation, DNA Purification, Cloning, Transgenic Assay, Expressing, Sequencing, Software, Microscopy
Journal: Cell
Article Title: Distinct Hippocampal Pathways Mediate Dissociable Roles of Context in Memory Retrieval
doi: 10.1016/j.cell.2016.09.051
Figure Lengend Snippet: KEY RESOURCES TABLE
Article Snippet: N/A TTX Latoxan, Valence, France L8503 CNQX Tocris Bioscience, Bristol, UK 1045 R-CPP Tocris Bioscience, Bristol, UK 0247 QX-314 Tocris Bioscience, Bristol, UK 2313 Picrotoxin Sigma-Aldrich P1675 Fetal bovine serum (FBS)
Techniques: Recombinant, Polymer, Plasmid Preparation, DNA Ligation, DNA Purification, Clone Assay, Transgenic Assay, Expressing, Sequencing, Software, Microscopy