matlab-based custom-built eeglab plug-in Search Results


99
Oxford Instruments 7 3 1 bitplane
KEY RESOURCES TABLE
7 3 1 Bitplane, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/7 3 1 bitplane/product/Oxford Instruments
Average 99 stars, based on 1 article reviews
7 3 1 bitplane - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

90
MathWorks Inc matlab-based custom-built eeglab plug-in
KEY RESOURCES TABLE
Matlab Based Custom Built Eeglab Plug In, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/matlab-based custom-built eeglab plug-in/product/MathWorks Inc
Average 90 stars, based on 1 article reviews
matlab-based custom-built eeglab plug-in - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
MathWorks Inc matlab plugin
Comparison between celltrackR and existing software for cell migration data. The table lists accessibility and implemented functionalities for each available resource (as assessed from the online documentation provided by the software authors).[ <xref ref-type= 17 - 25 ]" width="250" height="auto" />
Matlab Plugin, supplied by MathWorks Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/matlab plugin/product/MathWorks Inc
Average 90 stars, based on 1 article reviews
matlab plugin - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
MACHEREY NAGEL plasmid dna purification
KEY RESOURCES TABLE
Plasmid Dna Purification, supplied by MACHEREY NAGEL, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid dna purification/product/MACHEREY NAGEL
Average 90 stars, based on 1 article reviews
plasmid dna purification - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

94
Danaher Inc sh30070 03
KEY RESOURCES TABLE
Sh30070 03, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sh30070 03/product/Danaher Inc
Average 94 stars, based on 1 article reviews
sh30070 03 - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier

Image Search Results


KEY RESOURCES TABLE

Journal: Cell

Article Title: Distinct Hippocampal Pathways Mediate Dissociable Roles of Context in Memory Retrieval

doi: 10.1016/j.cell.2016.09.051

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: N/A TTX Latoxan, Valence, France L8503 CNQX Tocris Bioscience, Bristol, UK 1045 R-CPP Tocris Bioscience, Bristol, UK 0247 QX-314 Tocris Bioscience, Bristol, UK 2313 Picrotoxin Sigma-Aldrich P1675 Fetal bovine serum (FBS) Hyclone SH30070.03 Critical Commercial Assays Rapid DNA Ligation Kit Roche 11 635 379 001 Plasmid DNA Purification MACHEREY-NAGEL N/A Endotoxin-free Plasmid DNA Purification MACHEREY-NAGEL N/A In-Fusion HD cloning kit Clontech 639649 Experimental Models: Cell Lines B7GG Callaway E., Salk Institute N/A BHK-EnVA Callaway E., Salk Institute N/A HEK293-TVA Young J., Salk Institute N/A HEK293T Callaway E., Salk Institute N/A Experimental Models: Organisms/Strains C57BL6/J Harlan Ltd N/A hCAR (transgenic expression of a truncated human receptor for CAV-Cre) Pettersson, S., Karolinska Institutet, Tallone et al., 2001 N/A LSL-R26 Tva-lacZ (Rosa-LSL-TVA, Cre-dependent TVA expression) Saur, D., Technische Universitat Munchen, Seidler et al., 2008 N/A GAD2 Cre Huang, Z. J., Cold Spring Harbor Laboratory, Taniguchi et al., 2011 N/A GAD2 Cre ::LSL-R26 Tva-lacZ (GAD2-Cre-TVA) This paper N/A C57BL6/J::hCAR (F1) This paper N/A Recombinant DNA pSADΔG-ArchT-GFP This paper N/A pAAV-EF1α-DIO-rabG This paper N/A pcDNA-B19N Callaway E., Salk Institute N/A pcDNA-B19P Callaway E., Salk Institute N/A pcDNA-B19L Callaway E., Salk Institute N/A pcDNA-B19G Callaway E., Salk Institute N/A pSADΔG-F3 Callaway E., Salk Institute N/A Sequence-Based Reagents NheI-covering forward primer for Rabies G (GGCCAAGCTAGCATGGTTCCTCAGGCTCTCCTGT) Sigma-Aldrich N/A AscI-covering reverse primer for Rabies G (TTAAGGCGCGCCTTACAGTCTGGTCTCACCCCC) Sigma-Aldrich N/A Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ Fiji 1.48 http://fiji.sc/ TrackEM plugin in Fiji 1.48 Cardona A. and Saalfeld S. http://imagej.net/TrakEM2 Turboreg plugin in ImageJ Thévenaz et al., 1998 N/A GraphPad Prism GraphPad Software Inc http://www.graphpad.com/scientific-software/prism/ Imaris 7.3.1 Bitplane www.bitplane.com/imaris/imaris MATLAB The MathWorks, Inc. http://ch.mathworks.com/products/matlab IGOR Pro WaveMetrics https://www.wavemetrics.com/ Neuromatic plug-in for IGOR Pro Jason Rothman https://www.neuromatic.thinkrandom.com Zen softwares Zeiss http://www.zeiss.com/corporate/en_de/global/home.html pClamp 10 Axon instruments https://www.moleculardevices.com/ Other Optic fibers Thorlabs BFH48-200 Custom built optrode Lüthi A., FMI, Basel; Wolff et al., 2014 N/A Miniature epifluorescence microscope Inscopix nVista HD, version 2 Gradient index lens Inscopix GLP-0673 Blue (465 nm, 10 mW) and yellow (590 nm, 2.5 mW) LED with LED-driver LD-1 Plexon N/A Yellow laser (589 nm wavelength) CNI Lasers, China MBL589 Open in a separate window KEY RESOURCES TABLE

Techniques: Recombinant, Plasmid Preparation, DNA Ligation, DNA Purification, Clone Assay, Transgenic Assay, Expressing, Sequencing, Software, Microscopy

Comparison between celltrackR and existing software for cell migration data. The table lists accessibility and implemented functionalities for each available resource (as assessed from the online documentation provided by the software authors).[ <xref ref-type= 17 - 25 ]" width="100%" height="100%">

Journal: Immunoinformatics (Amsterdam, Netherlands)

Article Title: CelltrackR: An R package for fast and flexible analysis of immune cell migration data

doi: 10.1016/j.immuno.2021.100003

Figure Lengend Snippet: Comparison between celltrackR and existing software for cell migration data. The table lists accessibility and implemented functionalities for each available resource (as assessed from the online documentation provided by the software authors).[ 17 - 25 ]

Article Snippet: *With PACT, Track Manager, and Motion Profiler plugins , R package (RP), Java GUI (JG), ImageJ/Icy plugins (IP), Standalone (S), Matlab plugin (MP) , , , , automated/manual (A/M) track/image-based (TB/IB), *only based on distance/velocity , , , , , , , , , , , , , , , , , , , , , , , , , only with respect to specific point/direction (s), Hotelling's test (H), Rayleigh Test (R) , , , , , , pre-built plots only (PB), custom plots of any metric (C) , , , , *Using any statistical testing options from the R language , , , .

Techniques: Comparison, Software, Migration, Chemotaxis Assay

KEY RESOURCES TABLE

Journal: Cell

Article Title: Distinct Hippocampal Pathways Mediate Dissociable Roles of Context in Memory Retrieval

doi: 10.1016/j.cell.2016.09.051

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: N/A TTX Latoxan, Valence, France L8503 CNQX Tocris Bioscience, Bristol, UK 1045 R-CPP Tocris Bioscience, Bristol, UK 0247 QX-314 Tocris Bioscience, Bristol, UK 2313 Picrotoxin Sigma-Aldrich P1675 Fetal bovine serum (FBS) Hyclone SH30070.03 Critical Commercial Assays Rapid DNA Ligation Kit Roche 11 635 379 001 Plasmid DNA Purification MACHEREY-NAGEL N/A Endotoxin-free Plasmid DNA Purification MACHEREY-NAGEL N/A In-Fusion HD cloning kit Clontech 639649 Experimental Models: Cell Lines B7GG Callaway E., Salk Institute N/A BHK-EnVA Callaway E., Salk Institute N/A HEK293-TVA Young J., Salk Institute N/A HEK293T Callaway E., Salk Institute N/A Experimental Models: Organisms/Strains C57BL6/J Harlan Ltd N/A hCAR (transgenic expression of a truncated human receptor for CAV-Cre) Pettersson, S., Karolinska Institutet, Tallone et al., 2001 N/A LSL-R26 Tva-lacZ (Rosa-LSL-TVA, Cre-dependent TVA expression) Saur, D., Technische Universitat Munchen, Seidler et al., 2008 N/A GAD2 Cre Huang, Z. J., Cold Spring Harbor Laboratory, Taniguchi et al., 2011 N/A GAD2 Cre ::LSL-R26 Tva-lacZ (GAD2-Cre-TVA) This paper N/A C57BL6/J::hCAR (F1) This paper N/A Recombinant DNA pSADΔG-ArchT-GFP This paper N/A pAAV-EF1α-DIO-rabG This paper N/A pcDNA-B19N Callaway E., Salk Institute N/A pcDNA-B19P Callaway E., Salk Institute N/A pcDNA-B19L Callaway E., Salk Institute N/A pcDNA-B19G Callaway E., Salk Institute N/A pSADΔG-F3 Callaway E., Salk Institute N/A Sequence-Based Reagents NheI-covering forward primer for Rabies G (GGCCAAGCTAGCATGGTTCCTCAGGCTCTCCTGT) Sigma-Aldrich N/A AscI-covering reverse primer for Rabies G (TTAAGGCGCGCCTTACAGTCTGGTCTCACCCCC) Sigma-Aldrich N/A Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ Fiji 1.48 http://fiji.sc/ TrackEM plugin in Fiji 1.48 Cardona A. and Saalfeld S. http://imagej.net/TrakEM2 Turboreg plugin in ImageJ Thévenaz et al., 1998 N/A GraphPad Prism GraphPad Software Inc http://www.graphpad.com/scientific-software/prism/ Imaris 7.3.1 Bitplane www.bitplane.com/imaris/imaris MATLAB The MathWorks, Inc. http://ch.mathworks.com/products/matlab IGOR Pro WaveMetrics https://www.wavemetrics.com/ Neuromatic plug-in for IGOR Pro Jason Rothman https://www.neuromatic.thinkrandom.com Zen softwares Zeiss http://www.zeiss.com/corporate/en_de/global/home.html pClamp 10 Axon instruments https://www.moleculardevices.com/ Other Optic fibers Thorlabs BFH48-200 Custom built optrode Lüthi A., FMI, Basel; Wolff et al., 2014 N/A Miniature epifluorescence microscope Inscopix nVista HD, version 2 Gradient index lens Inscopix GLP-0673 Blue (465 nm, 10 mW) and yellow (590 nm, 2.5 mW) LED with LED-driver LD-1 Plexon N/A Yellow laser (589 nm wavelength) CNI Lasers, China MBL589 Open in a separate window KEY RESOURCES TABLE

Techniques: Recombinant, Polymer, Plasmid Preparation, DNA Ligation, DNA Purification, Cloning, Transgenic Assay, Expressing, Sequencing, Software, Microscopy

KEY RESOURCES TABLE

Journal: Cell

Article Title: Distinct Hippocampal Pathways Mediate Dissociable Roles of Context in Memory Retrieval

doi: 10.1016/j.cell.2016.09.051

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: N/A TTX Latoxan, Valence, France L8503 CNQX Tocris Bioscience, Bristol, UK 1045 R-CPP Tocris Bioscience, Bristol, UK 0247 QX-314 Tocris Bioscience, Bristol, UK 2313 Picrotoxin Sigma-Aldrich P1675 Fetal bovine serum (FBS) Hyclone SH30070.03 Critical Commercial Assays Rapid DNA Ligation Kit Roche 11 635 379 001 Plasmid DNA Purification MACHEREY-NAGEL N/A Endotoxin-free Plasmid DNA Purification MACHEREY-NAGEL N/A In-Fusion HD cloning kit Clontech 639649 Experimental Models: Cell Lines B7GG Callaway E., Salk Institute N/A BHK-EnVA Callaway E., Salk Institute N/A HEK293-TVA Young J., Salk Institute N/A HEK293T Callaway E., Salk Institute N/A Experimental Models: Organisms/Strains C57BL6/J Harlan Ltd N/A hCAR (transgenic expression of a truncated human receptor for CAV-Cre) Pettersson, S., Karolinska Institutet, Tallone et al., 2001 N/A LSL-R26 Tva-lacZ (Rosa-LSL-TVA, Cre-dependent TVA expression) Saur, D., Technische Universitat Munchen, Seidler et al., 2008 N/A GAD2 Cre Huang, Z. J., Cold Spring Harbor Laboratory, Taniguchi et al., 2011 N/A GAD2 Cre ::LSL-R26 Tva-lacZ (GAD2-Cre-TVA) This paper N/A C57BL6/J::hCAR (F1) This paper N/A Recombinant DNA pSADΔG-ArchT-GFP This paper N/A pAAV-EF1α-DIO-rabG This paper N/A pcDNA-B19N Callaway E., Salk Institute N/A pcDNA-B19P Callaway E., Salk Institute N/A pcDNA-B19L Callaway E., Salk Institute N/A pcDNA-B19G Callaway E., Salk Institute N/A pSADΔG-F3 Callaway E., Salk Institute N/A Sequence-Based Reagents NheI-covering forward primer for Rabies G (GGCCAAGCTAGCATGGTTCCTCAGGCTCTCCTGT) Sigma-Aldrich N/A AscI-covering reverse primer for Rabies G (TTAAGGCGCGCCTTACAGTCTGGTCTCACCCCC) Sigma-Aldrich N/A Software and Algorithms ImageJ NIH https://imagej.nih.gov/ij/ Fiji 1.48 http://fiji.sc/ TrackEM plugin in Fiji 1.48 Cardona A. and Saalfeld S. http://imagej.net/TrakEM2 Turboreg plugin in ImageJ Thévenaz et al., 1998 N/A GraphPad Prism GraphPad Software Inc http://www.graphpad.com/scientific-software/prism/ Imaris 7.3.1 Bitplane www.bitplane.com/imaris/imaris MATLAB The MathWorks, Inc. http://ch.mathworks.com/products/matlab IGOR Pro WaveMetrics https://www.wavemetrics.com/ Neuromatic plug-in for IGOR Pro Jason Rothman https://www.neuromatic.thinkrandom.com Zen softwares Zeiss http://www.zeiss.com/corporate/en_de/global/home.html pClamp 10 Axon instruments https://www.moleculardevices.com/ Other Optic fibers Thorlabs BFH48-200 Custom built optrode Lüthi A., FMI, Basel; Wolff et al., 2014 N/A Miniature epifluorescence microscope Inscopix nVista HD, version 2 Gradient index lens Inscopix GLP-0673 Blue (465 nm, 10 mW) and yellow (590 nm, 2.5 mW) LED with LED-driver LD-1 Plexon N/A Yellow laser (589 nm wavelength) CNI Lasers, China MBL589 Open in a separate window KEY RESOURCES TABLE

Techniques: Recombinant, Polymer, Plasmid Preparation, DNA Ligation, DNA Purification, Clone Assay, Transgenic Assay, Expressing, Sequencing, Software, Microscopy